kmanry84osb5q8 kmanry84osb5q8

Today at 4:48 AM
Mathematics

Answered

Write the following comparison as a ratio reduced to lowest terms.

22 feet to 92 yards

Answer :

Today at 4:54 AM

Answer:

11:46

Step-by-step explanation:

Divided by 2.

Answer Link

Other Questions

Which best describes nativism in the untied states in the 1800s

A line contains the points (34, 12) and (32, 48). What is the slope of the line in simplified form?

Place the numbers in the correct boxes.

Place the numbers in the correct boxes.

Hey big men i need help with this question if you get it right you get brainliest. no bots also

3.MATH PUZZLE BOXES Each puzzle contains the numbers 5-13. Each coloum and each row add up to the number given outside the boxes. Put the correct number in each

What preys on a tadpole?

What economic impact did the First World Warhave on India?

I am greater 2 plus 3 I am smaller 10 - 1 I am an odd number who am I

determine whether x-3 is a factor of x³-4x²+x+6

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

The Jones family received 23 pieces of mail on July 19. The mail consisted of ads, bills, letters, and magazines. How many ads did they receive if they received

Which region was home to Arkansas Confederate Capital? * Delta/Mississippi Alluvial Plain Crowley's Ridge O The Arkansas River Valley O The Ouachita Mountains T

What is the answer to this question?

Nucleic acids . combine to form carbohydrates store and transmit hereditary information are made up of amino acids form polysaccharides

Paint sells in metal cans one gallon each. How many gallons of paint must be purchased to paint a room containing 840 square feet of wall space, if one gallon c

For all values of x, which expression is equivalent to 4(5x+3)-4x? A) 12x+12 B) 16x+12 C) 16x+16 D) 32x+12

A gardener is buildng a wooden border around a rectangular flower garden. The garden is 2 feet wide by 5 feet long. What is the least amount of wood needed to m

Q4). Solve the equation 2x+1 = 2(1x/2 - 1) are represent the solution (s)1) on the number line2) on the cartesian scale

The graph shows the total fare, y, for a taxi ride with respect to the miles traveled, x. Use the graph to complete each statement. Drag and drop the answers in