daisyl07 daisyl07

Today at 4:21 AM
Mathematics

Answered

15
Sarah, Natasha and Richard share some sweets in the ratio 5:2:2. Sarah gets 21 more sweets
than Richard. How many sweets does Natasha get?

Answer :

cmckee660 cmckee660

Today at 4:26 AM

Answer:

natasha gets 14 sweets

Step-by-step explanation:

7x2=14

7x5=35

35-14=21

Answer Link

Other Questions

in the book Hatchet what does Brain mean by the word jumped, and chattered. in the vocabulary list there's nothing that fits the definition..

please help me with history

Y=[(X)] [(8-2X3³) ½ ]

Mr. Reynolds, the gym teacher, divided a class of 16 students into 2 equal teams. How many students were on the team?

please help me with history

solve each of the following equation and check your answer

4UC 2 at 3 coso, y=5+3 sino

the poet wants to go to the lonely meadows and sky

how dare they who were they?A snakes B crocodiles C lizards D all of the above

Till what distance above the earth surface we can use the formula g(1-2h/R) to find acceleration due to gravity

Are the lines C and D parallel? (The figure may not be drawn to scale). Giving brainliest for whoever answers correctly 1. Yes 2.no 3. Can’t be determined

What role did nationalism play in the imperialism of China?

A case of 24 pairs of the same kind of sports shoes costs a little more than $800. Explain whether $28 per pair with tax included is a good estimate of the pric

SORRY FOR ASKING ALOT BUT LAST QUESTION ON MY TEST PLS HELP ASAP TAKING NOW Falling Stars Video Game Level 1 2 3 4 5 Number of Stars 20 25 30 35 40 Total Possib

What quote best supports the idea that Bert, the horse trainer, is fond of Daffyd? A "Daffyd later decided that 'breaker' was the right word. Bert's methods wer

Which of the following is the INDEPENDENT variable ? A The height of the plants B The number of plants per pot C The amount of water D The amount of sun

why do the Earth's processes work in an endless cycle and not a linear process?

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Which of the following statements is a claim of fact?

why is it important to grendel that his death be viewed as an accident?